The mechanisms underlying this clinical phenomenon have been studied using in vitro models, leading to characterization of genes capable of conferring resistance to chemotherapeutic drugs. Different mechanisms have been characterized in MDR [1]. One of the mechanisms that is known to contribute to this phenomenon is the expression of the ATP-dependent P-glycoprotein. P-glycoprotein is included in a large super family of transport proteins termed, ATP Binding Cassette (ABC) transporters or traffic ATPases [2]. Among these genes, multidrug resistance gene (MDR1) has been of particular interest because its overexpression can lead to resistance to drugs such as anthracyclines, vinca alkaloids and podophyllins, which are important in the treatment of leukemia [3]. MDR1 gene, located on chromosome 7, encodes for a 170-kDa glycoprotein (P-gp). The broad spectrum of drugs affected by MDR1 has made it an attractive candidate to explain the phenomenon of clinical resistance, whereby leukemia cells or tumor becomes refractory to drugs to which it has never been exposed [4].

Clinical significance of MDR1 gene overexpression in leukemia at the time of diagnosis has suggested that it may be appropriate to include elevated MDR1 gene expression levels as an adverse prognostic factor in acute myelogenous leukemia (AML) [5].

Although drug resistance is intrinsically difficult to study in cancer patients, cell lines developed in vitro have provided significant insights on the mechanisms of multidrug resistance. Cell lines, which are highly resistant to a variety of anticancer agents, have been generated by slowly increasing the concentration of a cytotoxic agent in a stepwise fashion [6]. This approach selects for spontaneous or drug induced genetic alterations which provide a growth advantage in the selecting agent. A common phenomenon noted in cell lines selected with single, cytotoxic agent was that these lines were often cross resistant to a well-defined spectrum of structurally diverse compounds with distinct cellular targets [7].

HL 60 Cell Line
HL60 cells were obtained from Gülhane Military Medical School, Department of Haematology, Ankara, Turkey. HL-60/VCR, a vincristine-resistant line was developed by stepwise exposure of HL-60 to increasing concentrations of vincristine. The cells were grown in RPMI 1640 medium containing 10% heat-inactivated fetal calf serum (FCS), 500 U/ml penicillin and 0.5 mg/ml streptomycin in 25 cm² tissue culture flasks. The cells were incubated in CO₂ incubator at 37ºC in the presence of 5 % CO₂. The medium was refreshed every five days.

Cell Survival (MTT) Assay
2x10⁴ cells were plated in 100 ml of the growth medium in the absence or presence of increasing concentrations of VCR into 96-well plates at 37ºC in 5% CO₂ for 24 h and 48 h. The cells were then incubated with 3-[4, 5- dimethylthiazol-2-yl]-2,5-diphenyltetrazolium (MTT) (5 mg/ml) at 37ºC for 4 h. Then the medium was removed and the converted dye was solubilized with the addition of acidic isopropanol (0.1 N). Plates were examined by using a microplate reader at 570 nm and the concentration of drug that inhibited cell survival by 50% (IC₅₀) was determined from cell survival plots [8].

Isolation of RNA
Total RNA was isolated from 1x10⁷ sensitive HL60 and HL60/VCR cells by using Trizol reagent (consist of guanidium thiocyanate, phenol and sodium citrate). Quantification of RNA was conducted by spectrophotometer. Measuring the absorbance at wavelengths of 260 nm and 280 nm will provide information about protein contamination of RNA. Reading at 260 nm was used to calculate the concentration of nucleic acid in a sample [9]. The intactness of total RNA was confirmed by two sharp bands 28S rRNA and 18S rRNA [10]. Total RNA was stored at -80ºC.

Reverse Transcription
Reverse transcription was carried out for 60 min at 42ºC in a total volume of 20 µl, containing ribonuclease inhibitor (20 U), 0.5 mg oligo-dT, 2.5 mM of each dNTP and 200 units of Moloney Murine Leukemia Virus-reverse transcriptase and a sample of 3 µg of total cellular RNA. Once the cDNA copy created using the mRNA template, the PCR was conducted immediately or the cDNA was stored at -20ºC until required for analyses.

Polymerase Chain Reaction
Two sets of primers were used in all reactions to obtain amplification of an endogenous control, β-2-microglobulin (120 bases) and a specific target gene of interest, MDR1 gene (258 bases). Following an initial denaturation step of 94 ºC for 5 minutes, 35 cycles of PCR amplification were performed, each consisting of a denaturation step of 94 ºC for 30 seconds, annealing at 62 ºC for 45 seconds and extension at 72 ºC for 1 min. At the end of the 35 cycles, a 5-minute extension phase at 72 ºC was included to provide complete synthesis. The amplified fragments were visualized by running on 2% agarose gel at 90 V for 1 hour and then by ethidium bromide staining.

Primers were obtained from IDT, USA. The PCR primers used to amplify MDR1 gene were 21/20 nucleotide long oligonucleotides. The sequence of sense strand primer was 5'TACAGTGGAATTGGTGCTGGG and the sequence a n t i s e n s e s t r a n d p r i m e r w a s 5'CCCAGTGAAAAAATGTTGCCA. Nucleotides were chosen to avoid any co-amplification of MDR3 gene [11]. For the amplification of the β-2-microglobulin 20-mer oligonucleotides were used. The sequence sense strand primer was 5'CTTACTGAAGAATGGAGAGAGA and the sequence antisense strand primer was 5'CTTACATGTCTCTATCCCACTT [11].

Before application of Vincristine, HL60 cells were grown for a few weeks to adapt HL60 cells to laboratory conditions and to optimize the growth. Then different drug concentrations (from 1 nM to 50 nM) were applied to HL60 cells in a stepwise fashion. 10 nM and 50 nM VCR concentrations seemed to be critical for HL60 cells. At these drug concentrations longer periods were needed for growth and adaptation of cells. HL60 cells adapted to each drug concentration around 3-4 weeks. However cells were able to adapt to 10 nM and 50 nM VCR concentrations only after the 6-week incubation. Adaptation of HL60 cells to applied drug concentration was tested by Trypan blue method. By using this technique, percentages of viable and dead cells were determined under microscope. The next higher concentration of drug was applied to the cell line when 90% of cells were alive.

Expression of MDR1 mRNA
The intactness of total RNA was confirmed by two sharp bands which are 28S rRNA and 18S rRNA separated on denaturing agarose gels and visualized by ethidium bromide (EtBr) staining under UV light [10].

The target MDR1 and β-2-microglobulin as reference gene were amplified by PCR. The PCR product of MDR1 gene as 258 bp fragment and the PCR product of β-2- microglobulin gene as 120 bp fragment are seen in figure 1.

Fig 1: Agarose Gel Electrophoresis of PCR products from 40 nM and 50 nM VCR applied HL60 Cells. Lane 1. DNA Ladder, Lane 2. MDR1 expression in 40 nM VCR applied cells, Lane 3. β-2-Microglobulin expression in 40 nM VCR applied cells, Lane 4. MDR1 in 50 nM VCR applied cells, Lane 5. β-2- Microglobulin in 50 nM VCR applied cells

The level of target gene expression was determined by the intensities of the resulting PCR product bands on the gel. The ratio of band intensities of MDR1 gene and β-2- microglobulin gene was determined at each drug concentration. This ratio is an important parameter for the expression pattern of MDR1 gene.

MTT Cell Viability Assay
The IC₅₀ value at each drug concentration was determined from the cell survival plots and results are given in figure 4. IC₅₀ value for sensitive cells was found to be 4 nM. Whereas for HL60/VCR, it was 300 nM (Figure 2). In this study 50 nM of VCR was applied as the highest concentration and 75 times more resistant cells were obtained compared to sensitive HL60 cells (Figure 3).

Fig 2: Cytotoxic effects of vincristine (VCR) on HL60 cell. VCR resistant (HL60/VCR) (circles) and sensitive (HL60/wt) (triangles) cell lines were cultured with increasing concentration of VCR for 24 hours. The data depict the mean±SD of 3 separate experiments. The cytotoxic effect was most prominent at increasing concentrations of VCR on HL60/wt cells whereas the resistance was impressive on HL60/VCR cells (p < 0.001 at 100 nM of VCR)

Fig :3: IC50 values of VCR for HL60/wt and HL60/VCR cells

Fig 4: Micrograph of HL60 cells before application of VCR

It can be clearly seen from figures 4 and 5, the size of HL60 cells became smaller and the cell surface became rough as VCR concentration was increased. The shape of HL60 cells changed with the application of VCR. Cells may protect themselves against the toxic drug by becoming less permeable and they may express different sets of proteins on the cell membrane as a defense mechanism.

Fig 5: Micrograph of 50 nM VCR applied HL60 cells

In PCR, mRNA of β-2-microglobulin was used as an internal control. It has been shown that β-2-microglobulin gene expression was continuous and was not changed by exposure to VCR [12]. The level of target gene expression is reflected in the ratio between the intensities of the MDR1 and β-2-microglobulin PCR product bands on the gel. This ratio is used in comparisons of the expression levels of MDR1 gene.

PCR products of MDR1 gene and β-2- microglobulin gene from 40 nM and 50 nM VCR resistant HL60 cells are shown in figure 1. Normally HL60 cells do not express P-glycoprotein [13]. It was observed that HL60 cells started to express MDR1 gene in 2 nM vincristine. In the sensitive and 1 nM drug applied HL60 cells, MDR1 gene expression was not present. In 50 nM VCR applied HL60 cells (Figure 1), MDR1 gene expression was 6 times more compared to 2 nM VCR applied HL60 cells by densitometric analyses. The results strongly suggest that HL60 cells can survive at higher concentrations of VCR and this resistance can be explained by overexpression of the MDR1 gene.

The IC₅₀ values of VCR in sensitive and resistant HL60 cells were determined. IC₅₀ values were found to be 4 nM for sensitive cells and 300 nM for HL60/VCR cells (Figure 2). The results indicated that final HL60/VCR cells gained 75-fold resistance compared to sensitive HL60 cells. These results are comparable to those in literature [13,14].

Measurements of the expression of the MDR1 gene in AML cell line will be helpful in the understanding of drug resistance and predict drug responsiveness in leukemia before or during chemotherapy.

ACKNOWLEDGEMENTS
We thank Dr. Ferit Avcu for his helpful discussions and Bahar Baran for her help in preparing figures. This study was supported by Middle East Technical University fund AFP- 2001-07-02-00-38 grant.

1) Zijlstra JG, de Vries EGE, Mulder NH. Multifactorial drug resistance in an adriamycin-resistant human small cell lung carcinoma cell line. Cancer Res 1987;47:1780-4.

2) Greenberger LM, Williams SS, Distinct P-glycoprotein precursors are overproduced in independently isolated drugresistant cell lines. Proc Am Assoc Cancer Research 1988;85:3762-6.

3) Endicott JA, Ling V. The biochemistry of P-glycoprotein mediated multidrug resistance. Annu Rev Biochem 1989;58- 137-71.

4) Marie JP, Zittoun R. Multidrug resistance (mdr1) gene expression in adult leukemias: correlations with treatment outcome and in vitro drug sensitivity. Blood 1992;79:473.

5) Tsuruo T. Reversal of acquired resistance to vinca alkaloids and anthracycline antibiotics. Cancer Treatment Reports 1983;67:889.

6) Nielsen D, Torben S. P-glycoprotein as multidrug transporter: a critical review of current multidrug resistant cell lines. Biochimica et Biophysica Acta 1992;1139:169-83.

7) Skovsgaard T. Mechanism of cross-resistance between Vincristine and daunorubicin in Ehrlich ascites tumor cells. Cancer Res 1978;38:4722-7.

8) Ogretmen B, Bahadori H, McCauley M, et al. Lack of correlation of MRP and gamma-glutamylcysteine synthetase overexpression with doxorubicin resistance due to increased apoptosis in SV40 large T-antigen-transformed human mesothelial cells. Cancer Chemother Pharmacol 1998;42:441-6.

9) Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Edition, New York: Cold Spring Harbor, Section E5, 1989.

10) Ogretmen B, Ratajczak H, Kats A, et al. Effects of staining of RNA with ethidium bromide before electrophoresis on performance of northern blots. Biotechniques 1993;14:932-5.

11) Chen CJ, Chin JE, Ueda K. Internal duplication and homology with bacterial transport proteins in the MDR1 gene from multidrug resistant human cells. Cell 1986;47:381-9.

12) Jendiroba DB, Klostergaard J, Keyhani A, et al. Effective cytotoxicity against human leukemias and chemotherapyresistant leukemia cell lines by N-N-dimethylsphingosine. Leuk Res 2002;26:301-10.

13) Masao Hirose, Yasuhiro Kuroda. P53 may mediate the mdr1 expression via the WT1 gene in human Vincristine-resistant leukemia/lymphoma cell lines. Cancer Letters 1998;129:165- 71.

14) McGrath T, Latoud C, Arnold ST, et al. Analysis of resistance associated membrane proteins and levels of mdr gene expression. Biochemical Pharmacology 1989;38:3611-9.