[ Main Page | Editorial Board | About | Instructions ]
[ Table of Contents | Archive | Archive Search | Online Submission | Sponsor | E-mail ]

Turkish Journal of Cancer
2009, Volume 39, Number 3, Page(s) 095-103
[ Summary ] [ PDF ] [ Similar Articles ] [ Mail to Editor ]
C-kit proto-oncogene deletion and point mutation at exon 8, 17 in human acute myeloid leukemia
SYED RIZWAN HUSSAIN1, FAISAL AHMED1, HENA NAQVI1, PRADYUMN SINGH2, FARZANA MAHDI1, SUNIL G BABU3
1Era’s Lucknow Medical College & Hospital, Department of Biotechnology, Lucknow-India
2Christian Medical College, Department of Pathology, Vellore-India
3Babasaheb Bhimrao Ambedkar University, Department of Biotechnology, Lucknow-India
Keywords: Mutation, proto-oncogene, SSCP, exons, AML, c-kit receptor
Summary
Human genomic DNA from 90 cases of acute myeloid leukemia (AML) were screened for mutations in the c-kit gene. C-kit is a receptor tyrosine kinase class III that is expressed by early hematopoietic progenitor cells and plays crucial role in hematopoietic stem cell proliferation, differentiation and survival. Exon 8 and 17 are the frequent sites of mutations in the leukemia cases. To determine the spectrum of mutations at exon 8 and 17 of c-kit gene in 90 acute myeloid leukemia AML cases, we have done Polymerase Chain Reaction (PCR) Single-strand conformational polymorphism (SSCP) followed by DNA sequencing. The c-kit mutation frequencies in exon 8 were 25.55% (23/90) and in exon 17 were 34.44% (31/90) in AML cases. We have detected two contrary deletions Tyr 418del and Asp 419del in exon 8 in 23 cases and three point mutations that is Asp816Val, Asp820Gly and Asn822Lys in exon 17, in 31 cases; respectively. Each and every mutations detected in our study are located in region of the receptor’s extracellular domain and intracellular domain of second catalytic region. It gives the impression that incidence of mutation at exon 8 and 17 is elevated and possibly involved in clinical pathogenesis of AML and utilizable tool as the molecular prognostic marker. [Turk J Cancer 2009;39(3):95-103]
  • Top
  • Summary
  • Introduction
  • Methods
  • Results
  • Disscussion
  • References
  • Introduction
    Human c-kit, the cellular counterpart of v-kit derived from the Hardy-Zuckerman 4-feline sarcoma virus, is located on chromosome 4 and encodes a 145 kD receptor tyrosine kinase (RTK). Acute Myeloid Leukemia (AML) is one of the prevalent cancers of blood-forming cells in the bone marrow and heterogeneous disease in which hematopoietic progenitor cells attain genetic lesions that lead to a block in differentiation, increased self-renewal, and unregulated proliferation[1]. Apparently, it is known that c-kit is a proto-oncogene and activating c-kit mutations are likely to contribute in the development of leukemia among humans[2,3]. The c-kit is a cellular gene which codes for a transmembrane receptor kinase (Kit receptor, Kit-ligand or Steel factor) that is normally expressed in hematopoietic stem cells, mast cells, neural crest-derived melanocytes and germ cells. In context to humans, the ckit gene has been mapped to chromosome 4q12 adjacent to the highly homologous platelet derived growth factor receptor (PDGFR)[4-6]. Binding of stem cell factor initiates a sort of phosphorylation cascade that consequently leads to activation of various transcription factors that regulate apoptosis, cell differentiation and proliferation. A number of observations have suggested the role of c-kit, in connection to the development of a range of cells including hematopoietic cells in leukaemogenesis[7]. The augmented activation of c-kit gene with stem cell factor facilitate cell proliferation whereby in AML, an abnormal increase of proliferation occurs in two ways; first in case of AML, mutations of Asp816 in exon 17 and second in case of exon 8 c-kit gene lead to autonomous activation of c-kit gene, and also through over expression of c-kit gene in AML when c-kit gene is expressed in 80-90% of blast cells and point mutation of c-kit have been identified in 33-45% of AML cases[8-11]. AML accounts for about 90% of all acute leukemias in adults, but is rare in children[12]. The c-kit gene mutations in exon 17 is reported in gastrointestinal stromal tumors, Human solid tumors and Human germ cell tumors and exon 8 is reported in leukemia cases[13-18]. C-kit gene exon 8 point mutations at Thr417 and deletions of codons 418, 419 and 420 have been reported in cases of AML[16,19,20]. The report detailing exon 17 is Asp816Tyr substitution in the phosphotransferase domain of c-kit provides the first ever direct evidence for mutations in this protein leading to the development of human acute leukemia[21]. It is notable here that, no any study has been performed or reported the frequency and the prevalence of mutations in exon 8 and exon 17 of c-kit gene in AML cases in Indian population; to date. We have screened the c-kit gene responsible for the mutations by Single Stranded Conformation Polymorphisms (SSCP) followed by direct sequencing in a total of 90 cases of AML. Furthermore, our study has also explored the extrapolative implications of these mutations and pointed out how these mutations are interconnected with progression and clinical-pathogenesis in myeloid malignancy.
  • Top
  • Introduction
  • Methods
  • Results
  • Disscussion
  • References
  • Material and Methods
    Study samples collection
    The study group included 90 cases of AML. Ethical approval was obtained from the institutional ethical committee of Era’s Lucknow Medical College and Hospital, Lucknow, Uttar Pradesh, India. The peripheral blood or bone marrow samples were stained by Leishman stain method and the cases were classified, according to the FAB criteria[22]. 90 AML patients were classified as M0 (n = 15), M1 (n = 15), M2 (n = 15), M3 (n = 15), M4 (n = 10), M5 (n = 10), M6 (n = 5) and M7 (n = 5).

    Genomic DNA extraction
    Samples were collected from 90 routinely-processed unstained bone marrow slides and peripheral blood diagnosed as AML, from Department of Haematology at Era’s Lucknow Medical College and Hospital. Genomic DNA was extracted by Medox (DNA extraction kit, India) and DNA were stored in -20 degree Celsius temperature.

    Polymerase chain reaction and single-strand conformational polymorphism
    Polymerase chain reaction (PCR) was performed with 50 μl PCR reaction mixture containing 200-300 ng of template DNA, 10 pmol of each primer, 5 mmol/L of each mix dNTPs, 1X reaction buffer and 1 units of Taq polymerase enzyme (Fermentas, Germany) in an MJ Mini Thermocycler (Bio-Rad, UK). The cycling conditions denaturation at 94 °C for 30 seconds, followed by annealing at 55 °C for 30 seconds, and extension at 72 °C for 30 seconds, repeated for 40 cycles followed by a final extension step at 72 °C for 8 minutes using the following primers exon 8 forward 5- GGCCATTTCTGTTTTCCTGT -3 and reverse 5- TCTGCTCAGTTCCTGGACAA -3 and exon 17 forward 5- TTCACTCTTTACAAGTTAAAATG -3 and reverse 5- GGACTGTCAAGCAGAGAATG -3. Single-strand conformational polymorphism analysis was performed according to Orita et al.[23] with few modifications. Samples were denatured at 94 ºC for 5 minutes and immediately snap-cooled. 20 μl of amplified PCR product was loaded along with 20 μl denaturing dye on 12% polyacrylamide gel. Gel was run in pre-cooled 1X TBE (Tris Borate EDTA) buffer. The gel tank was placed in a cold room at 4 °C and run for 15 hours at 150 Volt. DNA on the gel was stained after electrophoresis with silver stain. Electrophoretic transpositions in single stranded DNA-PCR product among the samples were detected in contrast to the denatured-PCR products from the control carried out in contiguous pathway.

    Sequencing
    Amplicons were sequenced using an automated sequencer, ABI 3730XL DNA Analyzer (Applied Biosystems, Foster city, California, USA) and analyzed using FinchTV Software. Mutations were reconfirmed by sequencing amplicons in both directions and in independent second samples. Sequence was analysed using the BLAST (National Center for Biotechnology Information) and BioEdit software.

  • Top
  • Introduction
  • Methods
  • Results
  • Disscussion
  • References
  • Results
    Out of 90 AML cases 50 were male and 40 were female with age ranging from 2 years to 65 years. The mean age of cases was 30.3±1.0 years (mean age of male cases were 23.0±4.2 years and mean age of female cases were 38.5±5.6 years). The median WBC count in cases was 40,000 cells/μl/cumm (ranges from 15,000 to 80,000 cells/μl/cumm) and the median count of blast cells was 70% (ranges from >40% to >80%). The cases were classified according to the French-American-British (FAB) criteria (22) as AML, M0 (n=15), M1 (n=15), M2 (n=15), M3 (n=15), M4 (n=10), M5 (n=10), M6 (n=5) and M7 (n=5). Thirty one deletion mutations were found in 23 AML cases in exon 8 and 31 point mutations were detected in 31 AML cases in exon 17. The c-kit mutation frequencies in exon 8 were 25.55% (23/90) and exon 17 were 34.44% (31/90) in AML cases. Details of clinical data of deletion and point mutation in exon 8 and 17 are shown in table 1.

    Table 1: Outline of clinic based pathological data of c-kit gene deletion and point mutations in exon 8 and 17 in AML cases

  • Top
  • Introduction
  • Methods
  • Results
  • Disscussion
  • References
  • Discussion
    The c-kit gene is located in the human chromosome 4q11- q12. Exon 8 deletion mutations are localized between immunoglobulin-like loops 4 and 5 those are responsible for dimerization of the ligand-stimulating receptor at codon 418, 419 and exon 17 is located in intracellular region with juxtamembrane domain as separated in two domain regions first catalytic domain and second catalytic domain[24]. In the Indian population, our study is the foremost, to report mutations in the exon 8 and exon 17 fragment of c-kit gene in cases of AML. Previously, a molecular study has elucidated a number of mutations in the exon 8 and exon 17 in dissimilar sorts of tumors. Moreover, mutation at the Codon 417, 418, 419, 420 and 421 correspondingly in Exon 8 has been put out by Kohl et al.[17]. In particular terms, the deletion exists at the site of codon 419, in approximately 93% of all the exon 8 mutations and that was uncovered as a single abnormality in the AML patients[19]. Likewise, the mutation enclosing the deletions of amino acid 417 up to 419 and an additional insertion of Isoleucine Thr417Ile has been mentioned by Gari et al.[16]. The structural significance of the deleted region has been put forward by the involved amino acids, particularly Asp419, being highly conserved in the c-kit proteins of humans[6]. In our study, we have shown two contrary deletions, detected at exon 8 in 23 cases (Figure 1 and Table 2) (Tyr 418del, Asp 419del). Specifically; deletion of tyrosine were found at codon 418 in eight cases, in addition, at codon 419, deletion of Aspartic acid were found in each of 23 cases. Deletion at Tyr418 and Asp419 were jointly found in eight AML cases with M0, M1 subtype, respectively, while deletion at Asp419 was found in 15 AML cases with M0, M1, M2, M3, M4, M5 and M7 subtypes. In all the 2 codons 418 & 419 deletion mutations were found in AML with frequent entries at codon 419. The c-kit gene mutations specifically in exon 17 have been detected at many codons 813, 816, 818, 820, 822, 823, 825 are reportedly involved in human germ cell tumors, gastro-intestinal stromal tumors, human solid tumors as well as in leukemia; recurrently[13-15]. Exon 17 mutations at codon Asp816Val, Asp820Gly, Asn- 822Lys have already been reported[15,25-29]. The prime effect of Asp816Val can be recognized through functional studies that established its pathogenetic role in mast cell transformation more precisely, mutations of c-kit in exon 17 most commonly established in more than 90% cases of Systemic Mastocytosis (SM) as well as AML, which are considered to be associated in pathogenesis of disease[30-33]. Resultantly, confirmation to this finding came across with the identification of Asp816Val in modified mast cells in the patient with aggressive mastocytosis and an associated hematological disorder[34,35]. The earlier detection of a proximal mutation Asp820Gly in aggressive mast cell disease indicates to the fact that c-kit exon 17 is present in the second catalytic domain[36]. In our studies, we have detected eleven point mutations, i.e. Asp816Val, Asp820Gly and Asn822Lys, at exon 17 in 31 cases, respectively (Figure 2, Table 2). In addition, mutation at the codon 822 was spotted in thirteen cases whereas; mutation at codon 820 was detected in ten cases as well as mutation at codon 816 was identified in 8 cases (Figure 3). Most of the c-kit activating mutations apart from mutation identified between codon 813 to 825, which is found to be entirely in agreement with the others[25-29,34,36] Basically, these mutations are huddled in the same region as other known c-kit 17 mutations and in all probability coding for a constitutively activated protein; also. Noteworthy to quote here, that we have identified deletion and point mutations both at exon 8 and 17 in eleven cases of AML; respectively. The c-kit gene exon 8 and 17 mutations detected during our study, positioned between codons (412- 448) in exon 8 and (788- 828) in exon 17 is obvious endorsement of the earlier reported mutations within the diverse population which has been summarized in figure 4 and table 2. Summarily, this study is the first to report the presence of c-kit gene mutations in AML cases in Indian population. These observations suggest that c-kit gene mutations in exon 8 and 17 represent gain-of-function mutations that are susceptible to c-kit selective protein tyrosine kinase inhibitors. These findings point toward an important functional part of c-kit gene in exon 8 and 17 mutations in the pathogenesis of AML and provide the source for the c-kit gene that might represent functional molecular genetic markers in AML. Future studies in a larger group might be required to establish the extrapolative implications and to explore these mutations and their linkage with progression and clinicalpathogenesis in myeloid malignancy.

    Fig 1: Amino acid sequences of the exon 8 of c-kit gene. The sequence starts at codon 412 and terminate at 448. The wild-type sequence is shown above. Deletion mutations are shown in shades ■ and detected in case numbers 02, 03, 04, 08, 10, 13, 24, 31, 33, 35, 36, 41, 47, 49, 52, 54, 67, 73, 77, 78, 85, 88 and 90

    Fig 2: Amino acid sequences of the exon 17 of c-kit gene. The sequence begins at codon 788 and ends at 828. The wild-type sequence is shown above. Point mutations are shown in ■ and detected in case numbers 02, 03, 04, 13, 21, 22, 24, 25, 26, 29, 31, 33, 40, 41, 43, 49, 50, 52, 57, 58, 59, 63, 71, 75, 77, 78, 85, 86, 88, 90

    Fig 3: (A&B;&C;&D;). C-kit gene exon 17 point mutations (A): A→T, (B): A→G, (C): T→G (resulting in the amino-acid substitution (A): Asp816Val, (B): Asp820Gly and (C) Asn822Lys) and (D): exon 8 deletion mutations of 6 bp, TACGAC was found at codon 418 and 419

    Fig 4: Schematic representation of c-kit gene and location of c-kit gene mutations portray our results of deletions and point mutations in exon 8 & 17 and the distinctive molecular domains encompass three functional structures, e.g. NH2-terminal extracellular domain, transmembrane domain and COOHterminal intracellular domain, correspondingly

    Table 2: Comparison of reported mutations and the deletion mutations detected in our study of c-kit gene in exon 8 and exon 17

    Table 2: Comparison of reported mutations and the deletion mutations detected in our study of c-kit gene in exon 8 and exon 17 (continued)

    ACKNOWLEDGEMENT
    This complete study was supported by intramural grants on behalf of the Era’s Lucknow Medical College and Hospital, Lucknow-226 003, Uttar Pradesh (India).

  • Top
  • Introduction
  • Methods
  • Results
  • Discussion
  • References
  • References

    1) Mathers D, Colin C, Boschi-Pinto AD, et al. Cancer incidence, mortality and survival by site for 14 regions of the world. Global Programme on Evidence for Health Policy Discussion. World Health Organization 2001;13.

    2) Tse K F, Novelli E, Civin CI, et al. Inhibition of FLT3-mediated transformation by use of a tyrosine kinase inhibitor. Leukemia 2001;15:1001-10.

    3) Levis M, Tse KF, Smith BD, et al. A FLT3 tyrosine kinase inhibitor is selectively cytotoxic to acute myeloid leukemia blasts harboring FLT3 internal tandem duplication mutations. Blood 2001;98:885-7.

    4) Vliagoftis H, Worobec AS, Metcalfe DD. The protooncogene c-kit and c-kit ligand in human disease. J Allergy Clin Immunol 1997;100:435-40.

    5) Vandenbark GR, deCastro CM, Taylor H, et al. Cloning and structural analysis of the human c-kit gene. Oncogene 1992;7:1259-66.

    6) Yarden Y, Kuang WJ, Yang-Feng T, et al. Human proto-oncogene c-kit: a new cell surface receptor tyrosine kinase for an unidentified ligand. EMBO J 1987;6:3341-51.

    7) Reilly JT. Class III receptor tyrosine kinases: role in leukaemogenesis. Br J Haematol 2002;116:744-57.

    8) Cole SR, Aylett GW, Harvey NL, et al. Increased expression of c-Kit or its ligand Steel Factor is not a common feature of adult acute myeloid leukaemia. Leukemia 1996;10:288-96.

    9) Beghini A P, Peterlongo CB, Ripamonti L, et al. CKIT mutation in core binding factor leukemias. Blood 2000;95:726-7.

    10) Pardanani A, Tefferi A. Imatinib targets other than bcr/abl and their clinical relevance in myeloid disorders. Blood 2004;104:1931-9.

    11) Higuchi M, O’Brien D, Kumaravelu P, et al. Downing, Expression of a conditional AML1-ETO oncogene bypasses embryonic lethality and establishes a murine model of human t(8;21) acute myeloid leukemia. Cancer Cell 2002;1:63-74.

    12) Jemal A, Thomas A, Murray T, et al. “Cancer statistics “2002”. CA Cancer J Clin 2002;52:23-47.

    13) Ying-Yong H, Yun-Shan T, Meng-Hong S, et al. Ckit gene mutation in human gastrointestinal stromal tumors. World J. Gastroenterol 2004;10:1310-4.

    14) Sihto H, Sarlomo-Rikala M, Tynninen O, et al. KIT and Platelet-Derived Growth Factor Receptor Alpha Tyrosine Kinase Gene Mutations and KIT Amplifications in Human Solid Tumors. J Clin Oncol 2005;23:49-57.

    15) Tian Q, Frierson Jr HF, Krystal GW, et al. Activating c-kit gene mutations in human germ cell tumors. Am J Pathol 1999;154:1643-7.

    16) Gari M, Goodeve A, Wilson G, et al. C-kit proto-oncogene exon 8 in-frame deletion plus insertion mutations in acute myeloid leukaemia. Br J Haematol 1999;105:894-900.

    17) Kohl TM, Schnittger S, Ellwart JW, et al. KIT exon 8 mutations associated with core-binding factor (CBF)-acute myeloid leukemia (AML) cause hyperactivation of the receptor in response to stem cell factor. Blood 2005;105:3319-21.

    18) Yue-Ying W, Guang-Biao Z, Tong Y, et al. AML1- ETO and C-KIT mutation/ overexpression in t(8;21) leukemia: Implication in stepwise leukemogenesis and response to Gleevec. PNAS 2005;102:1104-9.

    19) Care RS, Valk PJ, Goodeve AC, et al. Incidence and prognosis of c-KIT and FLT3 mutations in core binding factor (CBF) acute myeloid leukaemias. Br J Haematol 2003;121:775-7.

    20) Goemans BF, Zwaan CM, Miller M, et al. Incidence and prognostic significance of c- kit exon 8 and 17 mutations in pediatric acute myeloid leukemia (AML) [abstract]. Blood 2003;102:198b-199b.

    21) Beghini A, Larizza L, Cairoli R, et al. C-kit activating mutations and mast cell proliferation in human leukemia. Blood 1998;92:701-2.

    22) Bennett JM, Catovsky D, Daniel MT, et al. Proposal for the classification of the acute leukaemias. French American British (FAB) cooperative group. Br J Haematol 1976;33:451-8.

    23) Orita M, Iwahana H, Kanazawa H, et al. Detection of polymorphisms of human DNA by gel electrophoresis as single-strand conformation polymorphism. Proc Natl Acad Sci USA 1989; 86:2766-70.

    24) Blechman JM, Lev S, Barg J, et al. The fourth immunoglobulin domain of the stem cell factor receptor couples ligand binding to signal transduction. Cell 1995;80:103-13.

    25) Nagata H, Worobec AS, Oh CK, et al. Identification of a point mutation in the catalytic domain of the protooncogene c-kit in peripheral blood mononuclear cells of patients who have mastocytosis with an associated hematologic disorder. Proc Natl Acad Sci USA 1995;92:10560.

    26) Pignon JM, Giraudier S, Duquesnoy P, et al. A new ckit mutation in a case of aggressive mast cell disease. Br J Haematol 1997;96:374.

    27) Lasota J, Wozniak A, Sarlomo-Rikala M, et al. Mutations in exons 9 and 13 of KIT gene are rare events in gastrointestinal stromal tumors. A study of 200 cases. Am J Pathol 2000;157:1091-5.

    28) Przygodzki RM, Hubbs AE, Zhao FQ, et al. Primary mediastinal seminomas: evidence of single and multiple KIT mutations. Lab Invest 2002;82:1369-75.

    29) Lizette V, Hongyan L, Al-Quran SZ, et al. Identification of c-kit gene mutations in primary adenoid cystic carcinoma of the salivary gland. Mod Pathol 2009;22:1296-302.

    30) Willmore-Payne C, Holden JA, Chadwick BE, et al. Detection of c-kit exons 11- and 17-activating mutations in testicular seminomas by high-resolution melting amplicon analysis. Mod Pathol 2006;19:1164-9.

    31) Tadashi H, Ting L, Syaifudin M, et al. Specific ckit Mutations in Sinonasal Natural Killer/T-Cell Lymphoma in China and Japan. Cancer research 2000;60:2345-7.

    32) Furitsu T, Tsujimura T, Tono T, et al. Identification of mutations in the coding sequence of the proto-oncogene c-kit in a human mast cell leukemia cell line causing ligand independent activation of c-kit product. J Clin Invest 1993;92:1736.

    33) Kanakura Y, Furitsu T, Tsujimura T, et al. Activating mutations of the c-kit proto-oncogene in a human mast cell leukemia cell line. Leukemia 1994;8:18.

    34) Lahortiga I, Akin C, Cools J, et al. Activity of imatinib in systemic mastocytosis with chronic basophilic leukemia and a PRKG2-PDGFRB fusion. Haematologica 2008;93:49-56.

    35) Cairoli R, Beghini A, Grillo G, et al. Prognostic impact of c-KIT mutations in core binding factor leukemias: an Italian retrospective study. Blood 2006;107:3463-8.

    36) Longley BJ, Tyrrell L, Lu SZ, et al. Somatic c-kit activating mutation in urticaria pigmentosa and aggressive mastocytosis: Establishment of clonality in a human mast cell neoplasm. Nat Genet 1996;12:312.

  • Top
  • Introduction
  • Methods
  • Results
  • Discussion
  • References
  • [ Top ] [ Summary ] [ PDF ] [ Similar Articles ] [ Mail to Editor ]
    Turkish Journal of Cancer web sitesi Novartis Onkoloji'nin karþýlýksýz eðitim katkýlarýyla hazýrlanmýþtýr.
    [ Main Page | Editorial Board | About | Instructions ]
    [ Table of Contents | Archive | Archive Search | Online Submission | E-mail ]